Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 80
Location 4216178 - 4216257 (+)
Sequence AACAGCAAGAACACCACCTCACCTTTCCTCCTCCTCCTCCTCCTCCTCCTCCACCGGCCT
CTCACACTCTCGATCTCACG
/rice/oryzabase