Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 168
Location 3802454 - 3802621 (+)
Sequence CACAAACCGAAAGTTGCCCTTCCTTTTGTAATAATAATAATAATAATAATAATAATAATA
ATAATAATAATAATAATAATAATAAAATCAAAAACATACTAGGAACAAACAAAACAAAAC
CTGAATTTATCTAACTAATCTCGCATCTACGTCTCGGTCTTCTCCGAA
/rice/oryzabase