Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 163
Location 301891 - 302053 (+)
Sequence ATGCAAGCATCTGCTTATGGATCTAAAGACAGAAATCCCAACTATGACGATAGTACAGAG
AGAGAGAGAGAGAGAGAGAGAGTTGCAGATGTCTCTTGATACTGAGTTGCCTTTGTAACT
TAACTACTGTAAGGAGGCATGGCATGGGAACAAAGTTACCAAC
/rice/oryzabase