Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 197
Location 207792 - 207988 (+)
Sequence ACTTGTCGAGAGCAGGAGTGATTTGCCAACCATCAGGGCATGATGCTGCAGAGAAATGGG
TGGCAGTTAATAATAATAATAATAATAATAATAAGGTAGTAAGTATGAATAATGAGAACC
CTGGCATCTGATACAAGGACGACAGTAGAGTATAGTGAAGTTAAAGAAGAAGGTGTGACA
GACATGAGGATGAACAC
/rice/oryzabase