Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 178
Location 1670678 - 1670855 (+)
Sequence GTACAACAGCAAGTGCAAGAGATGCTGCAGGGTGACGACGACTGTGCCGCGGCGCGTTAC
ACCGTGCCGCGATTGGGGCTGACGCTGGTGTACGGCTCCCCGCCTCGCCCGGGGTCCATT
TGCCCGGACCCAGCGACGACGACGACGACGACGACGACGGATAGCTCACATGCGCCAC
/rice/oryzabase