Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 263
Location 1669139 - 1669401 (+)
Sequence CAAACGGAGTGAGTACATTAGCACTCAACTGATGCAGTGAGCAATTTGAAGTAGAGAATT
ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGAAATAACCATGGCAAATT
ATAAGTTTCTGATCTCCGCCGCATGCATGAAGCTGGTGTGAACAGGAGCAACGACAATAT
GCAATGACGAATTCTTGTATATATGAGTATATGACTGAAAGTAAGAACACACTTCCCTGC
AGGAACCTGTACAGAACACATCA
/rice/oryzabase