Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 146
Location 1658078 - 1658223 (+)
Sequence GATTTCGATCTGACTGTCCCTAGCTAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGAT
GCACATGACCTTATCTAGTTGTTCTTTGTCCACGTTAATGTGTGTGTACAGTTAACAGTA
GATGCACAAGCAGCTGAGAAAGAAAG
/rice/oryzabase