Sequence Cutter Result

Sequence
Chromosome Build 5: chr1
Length 190
Location 1642243 - 1642432 (+)
Sequence AGTGTCAGAACCAGGATGAAATGCATGGTTAACAAGAAGTAATAGAGGTTAGTGGAATTA
ATGGTTATACCTTCGACGGGAACGTTCTCCGGTGATGGCACGGCGGCCGGAATGATATCC
TTCTGGCTCGACGCAGTGGCGGCGGCGGCGGCGGCGGCGGCCTTGGGCTCCTCATGGCTG
AAGCTGCACT
/rice/oryzabase