FASTA Format

FASTA Format

FASTA Format
Download Os01g0100800_nt.seq
Accession No. Os01g0100800
Length
4,636bp
Fasta Format
>Os01g0100800
ggcaagatcccacgggcgatgcgaacgagcaccggatccgctgcggctgctcggcgtcgg gtcggaggtgaggtctcgaaaccctagctgctccgacgacgatcgtggcagccgccgtcg ccatggtgctgggaaagatcgtcatcgtcatcggctccggtagggatccactctcgcgat ttctgtgcgtctaatctgtatgtatagggtagcttggcccaatcccccctctctctcgtt agcctctagctcgattcgctcctgctcctgtttgttgcttcatttactggagtagcttcg attagctttacttgtttggaaattgcaggaatcgttgggacattactcaccagcggagag gccaagattgcgctccccgattttagggatgtgctctctggtgccttcaaggttgttctt ttttctttcaatttcaatcattccttcctttcagtagtattttgtttttatttagagtaa atttcacaaaactacatattttatggttcacgttgcagaaaaccacatattttgatactt ggcacttaagtacatatattttggtagtttagtttcacaaaaccacactatcgatgaatg gattcacttgtgatatgacgacgtggttgtttcatctagtatgaggacgtggcatcatat taatttcgtgcgatggctggtaataggatgccatgtcctcgtcctaggtgaaacagccac atcatctcgcgggtgaatctatacatcgataatgtagttttgtgaaactacacgaccaaa atatatgtactcaagtgccaagtgtcaaagtgcgtgtggttttctgcaacttgtaccaca aaatatgtagttttgtgaaatttactcttttatttaagacataaaaggttcctttgctcc tttgctctgctctctagtttgtgaccaagcaagacaaaaaggatggcccatccaccagca gccctcacgctgctcacttgctatctcaggtctcccactcgtcatctcttactgtacttc atcgctggatggctccatgattaacccactgctcatctaactattaggtcaatcatctca gagaggacctccaacttttgtccaggtcaaatcaagttgctattgtcaccgtcgatggta gaccaggtctctcccattcttctctgttctgttgtatctgcagtgtgcttttttcctgga attattaaccataacctattaacctagtgatatttatgttttctttaccgtccatatcgt ttttcctgccaaccattatcttggaggaatacattaagcccattttctgatctaactaat ttatggaaacttgctcgtgaaatcgtttgatgcccttttggacaccaaatttttgtatgt aatttttgcagctacttcattgtcttctatactaacgctgacaaattctttcttttgcag gccctggtgcttatggtataacagctgttgttgctggggctatcggctatttatacataa ggtggaaggtaaaagtaatcactgattctcaacttggcagaagggtgctattgaacaatt ataaacacatcatcttagactatcagacaagcaaagttttctctttttctctctccttcc ttttcattttagggcaactgtcataatccacaaaatggggcaatcaagctaactcggtga tttacagggttggaaactttctgatttgatgtttgtgacgaagcgtggcttatctgatgc ctgcgatgtggttggcaaacagttggaacatgtttcagagaatgttaatgtaagtttctc cttcgttcactggaatatgaatattgcactatttgaagcttttacatgcatactgcaatg atcctatatttctctctttgggaagttggaactgttgtttgttgaatggagttcaatcct ttaacatcccgttaaagtttgtggcatactgtatgtcaatcactattggactgccacctc aaatgagagagtacacatcaggccgctcaattaaaatggttaaaggggaaatatctagtg aaaaccatcaaataaatgaaaacctgtgaaaaccggaccgaatctaaattcataacagtt tcctattactgttcacctgaaatttgtcttttttgttcctcccaaatgaagttgagtttt tacttaagatttggtgggaatgttgcctctagtttttttttcatgaatttagagaacttt taggtccggttttcacttatttgatggttttcaccagatatgtccacatggttagaatac cttggatttgcaggatgacctttcttggatatgaacatttacaattatgtgttgtttttg tatatggcatctttataattctattaagcattcttgacctatttggaccaaacaagaaaa gttaacctgagaaaacaaaacagaatctatgattcccacctcccactagatatgcctctg aacattttgaggctagctttgttatactgttgcatctgcgtgtgcttactcccactgttt gattcaaattcgtgtttatgtgcaatcttctgatatcaggctgcaaagaggcatctggca ggaagaatagatcatgtagattgtactttagatgaatgccaggaaattacagaatccaca agaaaagaggtttgaatgctcaagcattatgttaataggattttatatagtttattggag gttgatacaaaattaattcaataggttacagtcatccatgaagatataagtgccttccag gaggaaatgcaatcagttcatcttgtggttcgtactctggtaggtgccttgtattccgca tacacttctttttcaagataactcttttcctcactggtgctagatggaaactgacttctt cccttgtactacaggagacaaagcttggacgtctttcatatacccaagtaattaagagtt tgcaacaatataacttgctttacccccagaaatatgcattttgctaacctcttttactga aatgtcttaggatcgtacagcacgaggaatttatgacttatgcgagttcactaaaaggct ggataagagccccaaaactgatactcgtcaggcaagttagcacaatgcccaaaagctatt tttggcagaccttgctatgttgctagcctgaacttctattcccttacgatcccatactag aacattattgatataaaaaggcatacacttacacatgagtttctgatagattgtgtaaaa tgactgctcagacattgatttggcattataagttatgatatggctcctacatgaccaact ttaatctatttcttttgatccatgagatatccctcaggcaatgtccctcgacacagtttc tggcgtgataccaattacgatgtattaagtggcaccatgaagctttcttatatcatcctt ctatactgatagtcttgatttttcttaatcgatttccaggtcttatcatcaactcctctt ccagctattgaattgccagagagaattacaagggtaaagttgtgcacctttttgaatgtt aacatgatttggattatctgaccttttattttcttaccacaggctgcttctttgcctcca agttcagaaccggagttttctggccctcgatcacctgtaacagaggcatctaaggtcagg tctggttttgtgtctgaggacatgtttgacctgggttattgcatctaattatttttcttt tgcaggttgtgcattctcctacaactatgtcggcatcaggactgagtatgctagttgaaa catcaatgccacctaaaagggtaatatcatctaacatgcttttaaattgaatagagcgac tcatggcctattaagtgttaatgcttacgctgggaaagatgaagcacttcgcctgatgat tatagacattggaaatactagctgtttacaaagacgatggtgtattgactatgcttgagt gaacacattaatagtgagtctgcgttatactttctggcaatatgcccgagcttttatcac ttttcgttgctcgactaggtgtgccattgttgttaccttccaaaactctatagcactaaa tgcaaaccagaacgtaaggagtgtgtatgccctaaactgagcagcttaagttgtcttaat cctgcatgaatctccagggtgttttgagccgagcaagttctatgaaagaaggatcccagg agctatcaaatgggtcatcaagttcaggggaaccaaccactgggaggaatgttccaaatt caagactgtttggagggtttggttttttgaagagttctgccagttgagatacatggcatt gtcatggttttacccaaaggagttggattgacctttacgtgtatatgtattgctagctac taggtgccagtagaaaaatatgcagttgccccatggcatcactttcacctattggaagtg ccaattttttgtagaaattaattaatctatataccaaatacaaatgcattgcagagatat actgtttgtcggttgtggttgtaaaaaaaaactcgtaggggcagaaagagacacctgatt gcgtcttgttgcagcaagtttgtttggggaggatgtactggaataagggtatagtagtag taggaattattatggc
/rice/oryzabase