FASTA Format

FASTA Format

FASTA Format
Download Os01g0100600_nt.seq
Accession No. Os01g0100600
Length
4,052bp
Fasta Format
>Os01g0100600
acaagtcacagggaggagtcgaaaagagtcaataccagccgcgccaccgctccctcgctg acctgcccgtgttcgcccctctcgccggccgccgacccgcccctgctgctcaccgctcca gcctccgctcatcccaagccttccaccacaaccccccacccctgctcgcccgcgcaccca gctcaccagcgcacccgtctggggtctgcctgccgcttctccctcccgtgcaggtgcagg ggaagaggcaaggagggcaagaccggggcgcagtggggagtacggaggaagctggtgcag cgtgggagagagggagctggaaaagaaggaagaaaggggggcagtacaagggggacttgg gaggaggaagaagggggaatattttgagtatatgatcaatttcgccgtccaatccagatg tgcgccaaccaattcgctatggtataattgataataatgataccttccttgttgtatcta tctatctatctatctatctatctatctatctatctatctatctatctatctatcgatttc ttatctttctttgctcatgcctgacgatgtcatgtcacagctgctatgctatagcaatct ccttacttcaggattatcatgtatgtaaatcactagtaaatgtattacgagaatatatac aattaagcatgtatcacatcgatgtaattggcttagtacaataaagctttcattatctaa aaaaattacagttcttgtgttgctctgtgcgaacgaaactttaaactggaacaggttgag gagctggcttcactcatcaaggacaacctctacagcaagcacctcgtcctctctactgag gaaaccctcgtcgggatcctacagaaccagtaccacaactctgacgatgacgaggatgag gacgatatagtggcagcataccgcgggacaaataggaatatcctagagctccaacctgcc agctcctatcaacgtcttcttttgcatcgccttgccgacatctacgggtgctctttccaa ttccattcgacctgcttcacctaccctcttctcaaatactaacttaactggatagagtaa tatttgcaactactaatgtcttgcttttgtgtcgctgctaggtttgttcatgaatctgtt ggtgaaggtgaagatcgacacttagttctccagcgctgccctgaaactgccatgtatgat accaaaagtgaccacacatctctttgttattgagtgtcgtcttatgtctccctatgccct catttcgctgtttcttatactacaaacatgtacagtttaatttccacctgcatcattctt caatgcaatagaaaaaagggttaatagaaaaacacattgtttccacacaaaaaactgtct tcagggaaataaaacaaaagctatcccgtaaactcatgatcacatcttgtttgttattcc ttgccgtcttgctccaattgcatccctagttccacctgtggcgaaccatttggctgctca cactttaagataatcacgccatttgcctcccatagctattgtgttgactcagagcacgga agctgaaatcacacttttcttgtgacctacacatgagacattattctgtagttctattac ctctgattacttattatttcatattgcgcagcccacctgtcctcgtaagcgacgtattat gggagtatgacaacaaagatacatcgacatctgttgtagtgaagaggaaagatacaggtg aattgttataatttcattttgtggatcattcatgatgaagcattttgatggggtgacact accctgtagcacccatgctgccaattctgtttgtgctttagtaaatggtccatggagaag attcgtgtgtacttatgatccgttgttcggcttgtccgggctcaagaaaatttctggatc ctcctctgttttgttcccctacataaccactgtattacctgaccaatatatttttttttc tgaaaacaatcataatgccctttactcataaccctaagataccttccctaattaatgaaa tgggtccatagcggatcaagaaaaactaaaaaaaagtatgggaggataaaatgaagaatc agggcacactagaaattctcttcgcaaaaaaattatgaaatgattcctcttgatggtagt gaccaaatctggaaataggaactaggaagtcattgtgcagtgccttagcctgaatttatt tcaccctctcataaaaagggattaaaaatgcacagtatggtcgttgagcatgattcgcgt gacaaaggagtaaagctggctgctggatgccagctggagaaatactggtatttttttcca tgtgagtttgaagtgggtagtcaatttgacttacattttcatcgttccacaggcatagtt tgatgtgtcataagacattcagttccatagatatcttcttgttattcccttaaaaaagat atttcttattattctctcaagaaattctaagtgcaccatctgcacaaagaaaaacctatt ctacatgtataaatgtgatgcactgtgcaatcttatgtgtgtgtaacaggttaataatta gcattttgaattctcttctaacagatcttgaagaagcctggaaggaagatgcccaagaaa atatttctgctgaaatctcgcatttgaaaaatgatgcaggtacgttgcgcttgctgtcca cctctcaacaaagcgtctttcaaactgtcttagggtgtgtttggaactccaagttcccaa ctccattgctttgttttcgtacgcttttcaaactgttaaacgttgcgtttttttgcaaaa agtttctatacaaagttgcttttaaaaatcatattgatccaattttgaaaaaaatagcaa atacttaattaatcatgtactaatggaccgctccgttttccgtgccaactgtttgggatg ggaaccggcatatgcgaacgcagccttaagcttggttctctgcataatttcagtcgagga atttaagtctgaaaaaaaacccaatcaactcttttatttcagatttgaaggctttgcaaa agtcagttgcacccccagcaccgtcactcaaggagagggaagctgcttatcgagctgctc gcgagcgtatcttctcagcgcatgatgccaagggaaatgggacagcagtggcaaaaccta ggcatgttcctgctgttgctcaacggatgatcgcgcatgcacttggcaaaaaagttgaga gcccgacagagacagcagccgtgaagaatggcaaaggaaaggagccagcggaaagtagta ggaacaagttaaacccacgcacagcaggtggcaaggaagatagcaggtatgttgagaatg gcagaatgaggttgcacaccgggaatccatgtaagcagagctggcgtacaagtaacagta gagctgctagtagtgttagtcctgatgaactgaagagggagcaggttggagcggcaaaga ggatgtttgtgcatgccctgcggctgcctggtgttgaaggaagtgatggtccggtgcgga aaggcaagtaagagtcgagttgagatgggaggtgtaatgtaggtattaggatggagtgaa atggcaactctgtgatgattttcatctggtgatactatgctggtataagatgagatggaa ggcctggtatcccttggtggaagaagttgaagcgcaaaatgcaatgctggggatatgcaa gtggaagaagttgaagcgcaaaatgcaatgctgggggatatgcaagtggaagtggtgaga gctagctgcttgccgatggcagcagttgtggcaatattgagtgcaattgacaggtctttg tttgttttgtttttttttttgccagaagctgcagtttagcaggtccttattttcgtcaga agttacaaagagagaatatgccaatttttagctttatattttgctgaaggcagacaagtt gtagaggaatatgctgatccttagaaagaactttgtgtagcctatttggatggtttcaga ctttcagtgatagagtcggagcaatgttggtc
/rice/oryzabase