FASTA Format

FASTA Format

FASTA Format
Download AK241191_nt.seq
Accession No. AK241191
Length
1,715bp
Fasta Format
>AK241191
tgagttaaaatcatctttacttctagaggatacaaatatcatatccccaggcaggtagaa tacatagaaatatcggagcaatgctcaacgctttgctcagattaagaaatctcatacaat cataatctggttatttaggatataattcaaatcttattccaggcaccaaatagtcctgaa aaattttcttcgcctaatagtggtgccgccctgcaggaactctgagaccgctcttttccc aaatgcagtaattgttgccgtgagcaacgacatggaagtctgacgggattaagttgccca cgtcataccgtgtcccaatctttgttatgaccttatcatcgatcatggcgacatagacgt ctccctcagcagcaaggattttcagcttgctcccgggatgaatctcatttcttgatctca ctgcagctaatgtgctgatctcctgcttcaggttccagtcaaatacatggtcgtagaact gcacacatagtcaataaacagaatttagtcggagaaactggttgagaaaattagattttt ctttatggcattcgtattcatgcagctgaggactcacaatgcagggtactccagggtgtg tgaggatgtaggcgtagccctgcatgaccttgtcggaggggaacggccatgagttctgtg tggagccagtgtcatggttgtcgatgaaggtgacggccttctctggcagccagccaatca tccccggcgccttgccgttgccgtccttcatccgccacagctcaccttgcaccgccgcct gcagctcgcccttggtcgtgaagtcgaacgctgacgcagggccaccgacggcctgcgccc agttcaccagctcctgccggtcaccgtcctggttccacgacggctcaccgttgccgtcgt aacgcatgttgctccatatctcggcgacgacgaaggacgggtcggtgttgtcgacgtacg tcttggcgacggccgccgagtatcccttggcgaagtcgaggcgccagccgtcgaagccga cgtcggacttgagccaattgagccagtcggacagctctgtctgcacacgcgtgttgaggt ggtcgatgtcgggcgccgcgccgaagtctgcgccggtgtcgcggtgaccgcggccgttgg agtactgcgtgtcgtcgctgcagatcatgtcggggccccagtcgaggcggctgtccggcg tgccaccctcgaaaatgcagtagatgccacggctatccttgtaatccgcgcaccggtggt tgatgacgatgtcggcgacgcacttgatgcctttgctgtggaaggcggcgatcagcgacc tgagctctgcccccgtgccgtacttggaagcgtccaggtcgtagagccggcccggcatgt atccctgcggggcgacggagtgcgacggcggtgggagccagacgtgcgtgacaccggtcg cggcgatgtcgtcgacgtggccatggaggaagttgtaccacccgccctgcttcttccacg actcccagttgaacccctacaccaagaacagtcatgtcaaacgcaagtcattttttttta tgtaatgtgacattgtactacaggatgcttacctggaagaggacctgggcttgggccaag tgagagctcagacagagcaaggcgataaggaggaggctgctcattgaggctatgcgcttt gccattgctgcttctttcgagtagctgagttgtgt
/rice/oryzabase