FASTA Format

FASTA Format

FASTA Format
Download AK063988_nt.seq
Accession No. AK063988
Length
2,260bp
Fasta Format
>AK063988
acgcagcaagagccgatcgatcattgtccaagtctccaagcgatcagctagctgacttga cgacgctgcgagcagcggcagcaagagagcagcagcacaaagggttcccctttcacaagt gtccggccggctgcacgtaggccatggggaagcaaatggccgccctgtgtggctttctcc tcgtggcgttgctctggctcacgcccgacgtcgcgcacgcgcagacgcagatcctcttcc aggtgctttattcatttcacccataaacgggcaagggggttcacctgtgtaaaattatcg acagcaagtcagaacggctaatataattcacgtacaaccgaatacgtgtctgtaacattt ttgtgcagggttttaactgggactcgtggaagaagcagggtggttggtacaacatgctca aggaccaggtgggcgacatcgccagcgccggcgtcacgcacgtctggctcccacctccca cgcactccgtctcgcctcaaggccagcaagccatgcatctccttcatctcgttacgcttc tctttgtagcatgtccgtttctaaatatttgacaccattgactttttagcatatgtttaa ccgtttactttatttaaatttttttgtgaaatatgtaacactatatgtatacatataagt atatttaacaataaattaaatgataggaaaagaattaataattatttaaattttttaaat aagatgaacggtcgaacatatttaaaaatataacggtatgaaatatttagaaagggaggg agtatattacgtgacgtaaagtgtgttacggccagtgtcttactgcaattatcagctgat ctagctcatcaggcaattgacatgtatgcatgcatgtgtttaaatcgatttttcccgtgc atgcacgcaggctacatgccgggacggctctacgacctgaacgcgtccaagtacggcacc aaggcggagctcaagtcgctcatcgccgccttccacgccaagggcatcaagtgcgtcgcg gacatcgtcgtcaaccaccgctgcgccgacgacaaggacggccgcggcgtctactgcatc ttcaagggcggcggcccgcgcggctgcctggactggggcccctccatgatctgctgcgac gacacgcagtactccgacggcacgggccaccgcgacaccggcgccgacttcgccgcggcg cccgatatcgaccacctcaacccgctcgtccagcgggagctctccgactggctcaggtgg ctcaggagggatgtcggcttcgacggctggcgcctcgacttcgccaagggctactcggcg gccgtcgccaggacgtatgtccagaacgccaggccgagcttcgtcgtggcggagatatgg aactccctgagctacgacggcgacgggaagccggcggccaaccaggacggccagcggcag gagctcgtgaactgggtgaagcaggttggcggcccggcgacggcgttcgacttcacgacc aagggcatcctgcagtcggcggtgcagggcgagctgtggcggatgcgggacaaggacggc aaggcgccgggcatgataggctggtatcccgagaaggccgtcaccttcgtcgacaaccac gacaccggctcgacgcagcggatgtggccattcccgtctgacaaggtcattctgggctac gcctacatcctcacccacccaggagtaccatgcatcgtacgcaattaacttctcaaagct tgttataacatccatggatcgatgcttcatcattcataggtgacaattttgttttgtgtt gtttagttctacgaccacgtgttcgactggaacctcaagcaagagatcaacgcgctggcg gcgacgaggaagcgcaacgggataaacgccgggagcaagctgcgcgtcctggcggcggag agcgacatgtacgtggcgatggtcgacgagagggtcatcaccaagatcgggccgagaata gacgtgggcaacataatcccgtcggacttccacatcgtggctcatggcaatgactactgc gtctgggagaagagcggccttagagtcccagaaccagaaggtcggcgctagaaacggctc gcaagctagctacacagttcttaataacttggtcgcaaaaaaaaagttcttaataatttg tacgagaaatgttcgtttctgtttgcatatatagcttatgaaatcttaccaatatatact gctctgttttctatagttcatcccggaaatttgaacttgc
/rice/oryzabase