ZRSdelta401

Strain information
Strain ID MT1207
Strain Name ZRSdelta401
Strain Type Mutants
Characteristics A 401bp deletion was generated by CRISPR/Cas9 in the region harboring ZRS enhancer (Intron 5 of Lmbr1 gene, chromosome 20). ZRS enhancer drives expression of shh gene to pectoral fin buds. CRISPR targeted sequences are GTGAGTAATCAATTAAACGAGG and GTCCAGCTGTATTACCATGCAGG. The original background of this mutant is Cab strain. In pectoral fin buds, shh gene expression is reduced. In adult pectoral fins, the number of proximal radial bones is reduced.
Journal
  •    1  Hits.
    • Letelier J, de la Calle-Mustienes E, Pieretti J, Naranjo S, Maeso I, Nakamura T, Pascual-Anaya J, Shubin NH, Schneider I, Martinez-Morales JR, Gómez-Skarmeta JL. A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nat. Genet. 2018/04.50(4).504-509.
Special affairs [Address] ■ The RECIPIENT shall refer the following publication in any PUBLICATIONS.
(Name of the Publication: LETELIER, Joaquín, et al. A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nature genetics, 2018, 50.4: 504.)
■ The RECIPIENT shall give proper credit to the DEVELOPER in any publications reporting results of research using any derivatives developed from the BIOLOGICAL MATERIALS (hereinafter referred to as “the DERIVATIVES”), and shall procure other institutionsto which the DERIVATIVES are provided (including when provided through the NBRP) to do the same.
Category Mutants created by genome editing
Organization National Institute for Basic Biology
Frozen sperm in NIBB
Deposited by Universidad Pablo de Olavide
Order Request
Image

MT1207_ZRSdelta401
Upper pannels, expression of shh at 3 dpf is reduced in pectoral fin buds from ZRS 401 bp deletion mutants.
Lower pannels, the number of proximal radial bones is reduced in ZRS 401 bp deletion mutants.
Document (PDF) Genotyping protocol_ZRS mutants


/medaka