ZRSdelta401
Strain information | |
---|---|
Strain ID | MT1207 |
Strain Name | ZRSdelta401 |
Strain Type | Mutants |
Characteristics | A 401bp deletion was generated by CRISPR/Cas9 in the region harboring ZRS enhancer (Intron 5 of Lmbr1 gene, chromosome 20). ZRS enhancer drives expression of shh gene to pectoral fin buds. CRISPR targeted sequences are GTGAGTAATCAATTAAACGAGG and GTCCAGCTGTATTACCATGCAGG. The original background of this mutant is Cab strain. In pectoral fin buds, shh gene expression is reduced. In adult pectoral fins, the number of proximal radial bones is reduced. |
Journal
![]() |
|
Special affairs [Address] |
■ The RECIPIENT shall refer the following publication in any PUBLICATIONS. (Name of the Publication: LETELIER, Joaquín, et al. A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nature genetics, 2018, 50.4: 504.) ■ The RECIPIENT shall give proper credit to the DEVELOPER in any publications reporting results of research using any derivatives developed from the BIOLOGICAL MATERIALS (hereinafter referred to as “the DERIVATIVES”), and shall procure other institutionsto which the DERIVATIVES are provided (including when provided through the NBRP) to do the same. |
Category | Mutants created by genome editing |
Organization | National Institute for Basic Biology |
Frozen sperm in NIBB | ○ |
Deposited by | Universidad Pablo de Olavide |
Order |
![]() |
Image |
MT1207_ZRSdelta401 Upper pannels, expression of shh at 3 dpf is reduced in pectoral fin buds from ZRS 401 bp deletion mutants. Lower pannels, the number of proximal radial bones is reduced in ZRS 401 bp deletion mutants. |
Document (PDF) | Genotyping protocol_ZRS mutants |