ZRSdelta3.4kb

Strain information
Strain ID MT1209
Strain Name ZRSdelta3.4kb
Strain Type Mutants
Characteristics A 3.4 kb deletion was generated by CRISPR/Cas9 in the region harboring ZRS and shadow ZRS (sZRS) enhancers (Intron 5 of Lmbr1 gene, chromosome 20). Both enhancers drives expression of shh gene to pectoral fin buds. CRISPR targeted sequences are GTCCAGCTGTATTACCATGCAGG and TGGCCTCTAACGAGCCACACGGG. The original background of this mutant is Cab strain. In pectoral fin buds, shh gene expression is not detected by in situ hybridization. The pectoral fins are completely failed.
Journal
  •    1  Hits.
    • Letelier J, de la Calle-Mustienes E, Pieretti J, Naranjo S, Maeso I, Nakamura T, Pascual-Anaya J, Shubin NH, Schneider I, Martinez-Morales JR, Gómez-Skarmeta JL. A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nat. Genet. 2018/03/21.50(4).504-509.
Special affairs [Address] ■ The RECIPIENT shall refer the following publication in any PUBLICATIONS.
(Name of the Publication: LETELIER, Joaquín, et al. A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nature genetics, 2018, 50.4: 504.)
■ The RECIPIENT shall give proper credit to the DEVELOPER in any publications reporting results of research using any derivatives developed from the BIOLOGICAL MATERIALS (hereinafter referred to as “the DERIVATIVES”), and shall procure other institutionsto which the DERIVATIVES are provided (including when provided through the NBRP) to do the same.
Category Mutants created by genome editing
Organization National Institute for Basic Biology
Live in NIBB
Deposited by Universidad Pablo de Olavide
Order Request
Image

MT1209_ZRSdelta3.4kb
Upper pannels, expression of shh at 3 dpf is absent in pectoral fin buds from ZRS+sZRS. 3.4 kb deletion mutants.
Lower pannels, ZRS+sZRS. 3.4 kb deletion mutants lack pectoral fins.
Document (PDF) Genotyping protocol_MT1209


/medaka