ctsk:mEGFP

Strain information
Strain ID TG1131
Strain Name ctsk:mEGFP
Strain Type Transgenics
Characteristics The ctsk:mEGFP transgenic embryos express a membrane localized version of GFP in bone resorbing osteoclasts (see To et al., Comp Biochem Physiol C 2015 ). In early embryos, it is also expressed in ctsk positive cells in the head and in the tail fin, which are mesenchymal cells but not osteoclasts. First osteoclasts in the vertebral column appear at 21 days post fertilization. The membrane localized GFP interferes with osteoclast activity and can lead to adult fish (after 5-6 months) with bent or curved vertebral columns caused by an osteopetrosis-like lesion.
Transgene: A 3.18 kb upstream sequence of the cathepsin K gene (ENSORLT00000019682), including 80 nucleotides of exon 1 was amplified with primers ctskUP (GGGGTACCCCCGCTCTGCAGAAACTGT; contains KpnI site) and ctskDOWN (CGGGATATCCCGTCTGCAGCTGAAGTAGG; contains EcoRV site), and cloned in front of membrane-bound mEGFP into an I-SceI meganuclease vector.
Journal
  •    2  Hits.
Special affairs [Address] ■ The RECIPIENT shall refer the following publication in any PUBLICATIONS.
(Name of the Publication: TO, Thuy Thanh, et al. Rankl-induced osteoclastogenesis leads to loss of mineralization in a medaka osteoporosis model. Development, 2012, 139.1: 141-150
TO, Thuy Thanh, et al. An adult osteopetrosis model in medaka reveals the importance of osteoclast function for bone remodeling in teleost fish. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 2015, 178: 68-75.)
■ The RECIPIENT shall give proper credit to the DEVELOPER in any publications reporting results of research using any derivatives developed from the BIOLOGICAL MATERIALS (hereinafter referred to as “the DERIVATIVES”), and shall procure other institutionsto which the DERIVATIVES are provided (including when provided through the NBRP) to do the same.
Category Transgenic strains
Organization National Institute for Basic Biology
Frozen sperm in NIBB
Deposited by National University of Singapore
Order Request
Document (PDF) TG1131 ctsk-mEGFP plasmid map
Image

TG1131 ctsk mEGFP 6 wpf
Lateral view of ctsk:mEGFP medaka at 6 weeks post fertilization. GFP expression is seen in osteoclasts of hemal and neural arches in the vertebral bodies, and in fin rays. Expression at base of fins and in skull might be in cathepsinK-positive cells that are likely not osteoclasts.
NOTE that GFP is membrane localized. This can interfere with osteoclast function, resulting in an osteopetrosis phenotype (overmineralization; curved trunk) and lethality at 4-5 months (see To et al., Development 2012)


/medaka