|
ctsk:mCherry
| Strain information | |
|---|---|
| Strain ID | TG1130 |
| Strain Name | ctsk:mCherry |
| Strain Type | Transgenics |
| Characteristics |
The ctsk:mCherry transgenic embryos express mCherry in bone resorbing osteoclasts (see To et al., Comp Biochem Physiol C 2015 ). In early embryos, it is also expressed in ctsk positive cells in the head and in the tail fin, which are mesenchymal cells but not osteoclasts. First osteoclasts in the vertebral column appear at 21 days post fertilization. Transgene: A 3.18 kb upstream sequence of the cathepsin K gene (ENSORLT00000019682), including 80 nucleotides of exon 1 was amplified with primers ctskUP (GGGGTACCCCCGCTCTGCAGAAACTGT; contains KpnI site) and ctskDOWN (CGGGATATCCCGTCTGCAGCTGAAGTAGG; contains EcoRV site), and cloned into the KpnI and EcoRV sites in front of mCherry into an I-SceI meganuclease vector. |
Journal
|
|
| Special affairs [Address] |
■ The RECIPIENT shall refer the following publication in any PUBLICATIONS. (Name of the Publication: TO, Thuy Thanh, et al. Rankl-induced osteoclastogenesis leads to loss of mineralization in a medaka osteoporosis model. Development, 2012, 139.1: 141-150 TO, Thuy Thanh, et al. An adult osteopetrosis model in medaka reveals the importance of osteoclast function for bone remodeling in teleost fish. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 2015, 178: 68-75.) ■ The RECIPIENT shall give proper credit to the DEVELOPER in any publications reporting results of research using any derivatives developed from the BIOLOGICAL MATERIALS (hereinafter referred to as “the DERIVATIVES”), and shall procure other institutionsto which the DERIVATIVES are provided (including when provided through the NBRP) to do the same. |
| Category | Transgenic strains |
| Organization | National Institute for Basic Biology |
| Live | ○ |
| Deposited by | National University of Singapore |
| Order |
|
| Document (PDF) | TG1130_ctsk-mCherry plasmid map |
| Image |
TG1130_ctsk-mCherry_6 wpf Lateral view of ctsk:mCherry medaka at 6 weeks post fertilization. mCherry expression is seen in osteoclasts of hemal and neural arches in the vertebral bodies, and in fin rays. Expression at base of fins and in skull might be in cathepsinK-positive cells that are likely not osteoclasts. |
1 Hits.
