CLSTF07492     VD

Merge cluster information
Name CLSTF07492
Library ALL 42 cDNA [Download: FASTA]
olea 0 cDNA
oleb 1 cDNA [Download: FASTA]
oleb17m01 
olec 0 cDNA
olvl 0 cDNA
olli 0 cDNA
olbr 1 cDNA [Download: FASTA]
olbr63a02 
olgi 4 cDNA [Download: FASTA]
olgi11l06  olgi32d20  olgi61o22  olgi65k23 
olki 3 cDNA [Download: FASTA]
olki16p08  olki57i03  olki61e03 
olsp 2 cDNA [Download: FASTA]
olsp15m14  olsp31c20 
olte 31 cDNA [Download: FASTA]
olte10b23  olte15n12  olte1n02  olte20p04  olte21j17  olte21n10  olte22h04  olte25m20  olte27j18  olte29b08  olte29k08  olte2i21  olte31h07  olte33g16  olte38f06  olte38j07  olte40g15  olte43k16  olte44h23  olte45h05  olte49b06  olte51g08  olte51m07  olte52i19  olte56e11  olte59j10  olte61f21  olte67o11  olte68o02  olte68p04  olte9e07 
olova 0 cDNA

Before using Assemble Viewer, please ensure that you have the latest version of Java. If you are not using the latest Java version, please download it here. http://java.com/ja/download/


Contig information - 1
Name Contig1
Clone count 28 clones
Length 493
Assemble Result Assemble Viewer
Homology(BLAST)
Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 314
Evalue 1.4737e-27
Detail
Sequence [Download: FASTA]
>Contig1
GAGATCAAGCCGTTTTCATGGTAACTTCAATCGACCGACTGCAGAAACAGCAGACCGCAATCTGA
TCAGCATGGGGAAGATTTACCAGGTGGTCGTCCACGGTCTGAGAGGGGAGAAGATGGTGATCGAT
CTGTGTAACACCGAAGAACAAATGCAGAAGATGACAGTTCTGCAGCTGAAGGAGAAGATAGCTCA
GAGACTCCCTGAAAGCGCAGGAGAGGAATCTCTGCGTCTGATCTTCACGGATAAGATGTTGGATA
CAGACTCCAAGCTGCTGTCCGAATATGGAATCCAGAACTTGTCTGTAATCCACATGGTGATTAAA
GTTCCTGGAGGACTTTAAGTGTCACTGCAAGCATCTGCACGTTGACCTGCTGCTGCTTTCATCTG
CCATGTTCTGGACTCTTTTTGGTTTTGTTTCATTGTCTGTTCACAGTTTTTAAAGTATTGTTGCT
CAAAATAAAATGAAAAATGAAAAGTAATAAAAAAAAAA
/medaka