CLSTF05067     VD

Merge cluster information
Name CLSTF05067
Library ALL 33 cDNA [Download: FASTA]
olea 3 cDNA [Download: FASTA]
olea34k11  olea39a23  olea59l06 
oleb 1 cDNA [Download: FASTA]
oleb58j20 
olec 1 cDNA [Download: FASTA]
olec64e15 
olvl 0 cDNA
olli 1 cDNA [Download: FASTA]
olli64a10 
olbr 0 cDNA
olgi 0 cDNA
olki 2 cDNA [Download: FASTA]
olki37i15  olki44j02 
olsp 2 cDNA [Download: FASTA]
olsp49b06  olsp64e11 
olte 16 cDNA [Download: FASTA]
olte10c04  olte14a12  olte17o06  olte25g13  olte2n11  olte31f19  olte36c09  olte36g09  olte38i19  olte39a07  olte44k15  olte46m22  olte53m04  olte56k16  olte5i17  olte63i22 
olova 7 cDNA [Download: FASTA]
olova29f08  olova35k01  olova37h07  olova39c03  olova57a23  olova59c02  olova62l04 

Before using Assemble Viewer, please ensure that you have the latest version of Java. If you are not using the latest Java version, please download it here. http://java.com/ja/download/


Contig information - 1
Name Contig1
Clone count 31 clones
Length 1058
Assemble Result Assemble Viewer
Homology(BLAST)
Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 1216
Evalue 1.95924e-131
Detail
Sequence [Download: FASTA]
>Contig1
GGGAAGTGTGTCGTGTCTCGCGGTTTTGTGTCGTCATCGTAACTGCAGTTACGCACGTTGCTAGT
TAGTTGCAATGTTGTAGCTATTAGCGCGAGGCCGTTTCTTCTCTGGGGGGGCCAAACCCTGAAGG
ACACCGACCCCCGCTCCTCACACCCGCACCCGCTCGACTGCTCCCCGTTACCCGACAGCCGCTCC
TCCGCTCCCGGTTCGTTAGCGGGCCCCGTTTGTTCGCCGCCTCCTTCCGCGAGCGCGACGGTTCC
GGCGGCGGCTGAAGACCACCAACCATGGCCATGAGGCAGACCCCCCTCACCTGTTCGGGTCACAC
CCGACCCGTGGTGGACCTGGCTTTCAGCGGAATCACGCCTTTCGGATACTTCCTCATCAGCGCCT
GCAAGGATGGCAAGCCCATGTTGCGCCAAGGAGACACAGGAGACTGGATCGGAACGTTTCTTGGT
CACAAAGGTGCTGTTTGGGGGGCCACTCTGAACATGGACGCCACCAAAGCCGCCACCGCCGCCGC
CGACTTCACAGCGAAGGTGTGGGACTCGGTCAGCGGAGACGAGGTCCTGTCTCTGGCGCACAAAC
ACATCGTCAAGTCTGTGAACTTCACTCAGGACAGCAACCACCTTCTGACGGCGGGAAACGACAAG
CTGCTGCGCATTTTCGACCTCAGCAACACCGACGCAGCCCCACAGGAGATCGCAGGTCACGGCGC
AGCCATCAAGAAGGCTCTGTGGTGCAACGACGACAAGCAAATCCTCTCTGCAGCCGACGACAAAA
CCATCCGGCTTTGGGACAGGACCTCCATGGAGGAGGTGAAGACCCTCACGTTCAACACATCTGTG
AGCAGCATGGAGTACATGGCTGATGGAGAGATCCTGGTGATCACTTATGGAAAGACCATCGCCTT
CTACAACGCTCTGAGCCTGGAGCTGATCAAGACTGCGGAGGCTCCGGCTCCAATCAACTCGGCCT
CCCTCCATCCAGAGAAGGACTTCTTTGTGGCGGGAGGAGAAGACTTCAAGCTCTACAAGTTTGAC
TACGGCACGCAGGAGGAG
/medaka