olte10b02

Clone Detail
clone name olte10b02
accession no FS512092
direction 5'
tissue cluster CLSTF00636 (32)
merge cluster CLSTF00402
Sequence gggttcggactttgaatgtaccatgttcatgtctgtccccttcgtgtttgtgcgaagtaaaacct
ccacaaaagctaagttactgtctctgagtcattattcattatttctgtgtgtaagaaactgacgg
ggtaacgaacctaaaaatattcctattttacagtcctttctagaaaatccagtttcttcacattt
ggtccttctgagccggccggcgcgcgccctggacatcgctggaacccctggggggggttgcctga
aaaccgctagcggtctgagatcacagcctcagcattgaccaatccgccttcaggatcggcggccc
tcgcccttgggtccggtggtgcccccggtgacgtcggaccctcatcaaatagcgacgttcattgc
ttgaaactctgcatcctgaccagaaggcctctgtcggtgacctgctttaccctgaagaccattta
acggactgattggtcacacccaggtggacaggcccctacaaggttctcctcaccatgccacctac
agtacacattgctgaacgaccctcctggattcacgtaagccactgtaaattgctganagcctatg
agactgacattttgagacccatccctggttgaa
Note
Request Request  
Reference
Homology(nr)
Score 122
E-Value 4.09251e-05
definition pol protein [Porcine endogenous type C retrovirus]  
Homology(Genome)
Chr. no 7
From 22217814
To 22218208
Strand +
Genome Viewer (Genome Viewer)
/medaka