olte10a07

Clone Detail
clone name olte10a07
accession no FS512073
direction 5'
tissue cluster CLSTF00168 (13)
merge cluster CLSTF02876
Sequence ggttcaagagttagagtctggcataaaagacgatggacccgtttaacgaggaagataaaatgtat
ctttttgaaaacagattgaaaacctttgaaaattggcctttcgacaaagactgcacctgcacccc
ggagaacatggccagagctggctttgtccacacgccctcagacaacagcccagacatcgccatgt
gtttcttctgcctcaaagagctggagggctgggagccagacgacgacccacagaaggagcacaaa
tctcacgcaccttcctgcagcttcatctctttaaccaaaaacgttgaggacctgactatggaaga
attcttcaaactccaaaaggagaaagacaaaattatcaccaaaaaaaggtgcattgaagccatca
ccaagtttgaggaggcagccaaagtgaggcgagagaagatcatcaagacagccagaggagaagag
tgacactggagtggaggaaggagaagggggttcaaaagaaaacggctgtcagtgcagtgattccc
gtttatgattttttttgtcctctttgttgtgttgtatataaatatcctgaatgatttttattcat
cgcattttactgatatttgtttcttttttaaaactgttcgtttttattgttattattacggtata
aatanagatgttcc
Note
Request Request  
Reference
Homology(nr)
Score 564
E-Value 2.69505e-56
definition Baculoviral IAP repeat-containing protein 5 [Salmo salar]  
Homology(Genome)
Chr. no 19
From 2334257
To 2334555
Strand -
Genome Viewer (Genome Viewer)
/medaka