MF01SSA001b04

Clone Detail
clone name MF01SSA001b04
accession no
direction 5'
tissue cluster CLSTF00011 (65)
merge cluster CLSTF00447 (242)
Sequence tgcaggcaattcggcacgaggcggacgcagaaaaaaagttccggcggtccctgagnagccttttg
aaaaggcgaaaggcctatgcagcaatgaaggccatgcgtgtcaagaagttgctggctgagaaaaa
ggcccgtaaggtgaccaggaaactcatatacaagagggctgagaagtaccacaaggagtacaggc
agatggagaggcgtgagatccgcctggctcgtatggctcgcaaagtcgggaactactatgtgcca
gctgaacccaaactggcctttgtcatcaggatccgaggtatcaacggagtcagccccaaggtccg
caaagttctgcagcttctccgtctgcgccagatcttcaacggtgtatttgtcaagctgaacaagg
cttcaatcaacatgctgaggattgctgagccttacattgcttggggataccccaacttgaagtct
gtgcgagagctcatctacaaacgtggctacggcaggatgaggaagcagcgcatcgccctcacaga
caatgctttggtggagaaagctcttggcaaatatggcatcatctgtgttgaggacctcatccatg
aaatctacactgttggaaagaacttcaagcctgccaacaacttcctgtggcccttcaaactgtcg
tcacctcgtggaggaatgaacaagaagaccacacactttgtggagggaggcgacgccggcaacag
ggag
Note
Request Request  
Reference
Homology(nr)
Score 1150
E-Value 5.09235e-124
Frame 3
definition ribosomal protein L7 [Oryzias latipes]  
Homology(Genome)
Chr. no 20
From 14417030
To 14417203
Strand +
Genome Viewer (Genome Viewer)
/medaka