|
rolova35g22
| Clone Detail | |
|---|---|
| clone name | rolova35g22 |
| accession no | DK217158 |
| direction | 3' |
| tissue cluster | CLSTR00162 (28) |
| merge cluster | CLSTR00045 |
| Sequence |
gcatctcaaactctgcttcacatgggctttggaggagctcttggtgcgccggcagccggcctgaa tctgggcggcggggtgcggtcttttctggcctcacgagagcggtttctcaccactttactgtgga tggcacagctgacacaatagtgcagcttcacatagagcttgggaaggacatacgagtcaaagacg ctggcctctgagatgtccctcacagctgctgcctccactatgttcctgatgacaaacttcttgat ggctttgtcctttggaacacagcgggcgcagttggtgcagcggatgggctgcacatgcccacggc ccttcttggcacgtccgttattccttctcttcttagtcatgttgaacgggaagatggaaagagc |
| Note | |
| Request |
|
| Reference |
|
| Homology(nr) | |
| Score | 406 |
| E-Value | 1.89998e-38 |
| definition | PREDICTED: similar to Ribosomal protein S26, like [Monodelphis domestica] |
| Homology(Genome) | |
| Chr. no | 5 |
| From | 2311927 |
| To | 2314282 |
| Strand | - |
| Genome Viewer |
(Genome Viewer)
|
