|
olgi10a13
| Clone Detail | |
|---|---|
| clone name | olgi10a13 |
| accession no | |
| direction | 5' |
| tissue cluster | CLSTF00126 (198) |
| merge cluster | CLSTF00748 |
| Sequence |
atgttggccccctaaaggaaagaacagtctttgtcctggtttacttcacttaaaataatgtttaa aaaaaaaaggtaacaaccatgcactactgtggaaactcttgagaaaatgtgcttttttttgtttt ttttccatgaaacctgaccttgtttgaaatgtaattgcatgcaatttgactgtttggatttcaag aaaatgcaaataaaaatctctttctctaaaaaaaaaa |
| Note | |
| Request |
|
| Reference |
|
| Homology(nr) | |
| Score | 78 |
| E-Value | 2.71885 |
| definition | Phosphoinositide PI4,5P(2) binding protein, forms a complex with Slm2p; acts downstream of Mss4p in a pathway regulating actin cytoskeleton organization in response to stress; subunit of and phosphorylated by the TORC2 complex; Slm1p [Saccharomyces cerevisiae] |
| Homology(Genome) | |
| Chr. no | 16 |
| From | 15504758 |
| To | 15504982 |
| Strand | + |
| Genome Viewer |
(Genome Viewer)
|
