National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS02693 
 Genotype y1 sc v1; P{TRiP}attP2/TM3,Sb 
 Reference Katsukawa M, Ohsawa S, Zhang L, Yan Y, Igaki T.
Serpin Facilitates Tumor-Suppressive Cell Competition by Blocking Toll-Mediated Yki Activation in Drosophila.
Curr Biol (2018) 28(11) 1756-1767.e6 [ PubMed ID = 29804808 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG10913 
 Symbol Spn55B 
 Full Name Serpin 55B 
 Synonym CG10913, sp-6, Sp6, Spn55B, Spn6, sp6 
 FBgn FBgn0028983 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 1 out of 1 
 Transcripts
CG10913-RA 
 Accession NM_080214
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH04642.N 
 21bp_seq_sense_
TCCGGTGTAGACAGCAGACCA 
 21bp_seq_antisense
TGGTCTGCTGTCTACACCGGA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.