|
|
| TRiP Strains Detail |
| Request : Click the "Order" button to request for this stock |
|
| Stock Detail |
| TRiP No |
HMS02693 |
| Genotype |
y1 sc v1; P{TRiP}attP2/TM3,Sb |
| Reference |
Katsukawa M, Ohsawa S, Zhang L, Yan Y, Igaki T.
Serpin Facilitates Tumor-Suppressive Cell Competition by Blocking Toll-Mediated Yki Activation in Drosophila.
Curr Biol (2018) 28(11) 1756-1767.e6
[
PubMed ID = 29804808
]
[
RRC reference
]
|
| Comment |
|
|
Gene Target: FB2014_04, released July 21st, 2014 |
| CG No. |
CG10913 |
| Symbol |
Spn55B |
| Full Name |
Serpin 55B |
| Synonym |
CG10913, sp-6, Sp6, Spn55B, Spn6, sp6 |
| FBgn |
FBgn0028983 |
| Gene Loc. |
2R |
| Gene Target Summary |
Target 1 gene, all isoform(s) |
| Gene target |
1 |
Transcripts targeted |
1 out of 1 |
| Transcripts |
CG10913-RA |
| Accession |
NM_080214
|
| Vector Information |
| Vector |
VALIUM20
|
| RNAi expressed |
soma, germline
|
| Hairpin Location |
attP2
|
| Hairpin ID |
SH04642.N
|
| 21bp_seq_sense_ |
TCCGGTGTAGACAGCAGACCA
|
| 21bp_seq_antisense |
TGGTCTGCTGTCTACACCGGA
|
|
|
