National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS02185 
 Genotype y1 v1; P{TRiP}attP40 
 Reference Ma H, Zhao H, Liu F, Zhao H, Kong R, Shi L, Wei M, Li Z.
Heparan sulfate negatively regulates intestinal stem cell proliferation in Drosophila adult midgut.
Biol Open (2019) 8(10) [ PubMed ID = 31628141 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG14026 
 Symbol tkv 
 Full Name thickveins 
 Synonym Atkv, Brk25D1, TKV1, tkv1, Brk25D, l(2)04415, kv, STK-A, Dtfr, str, l(2)25Da, Brk25D2, Tkv, tkva, dtfr, CG14026, TKV, Atr25D 
 FBgn FBgn0003716 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 4 out of 4 
 Transcripts
CG14026-RA, CG14026-RD, CG14026-RB, CG14026-RC 
 Accession NM_175975NM_175978NM_175977NM_175976
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP40 
 Hairpin ID
SH04061.N 
 21bp_seq_sense_
CAAGCAGTTTGAAGAGTTCAA 
 21bp_seq_antisense
TTGAACTCTTCAAACTGCTTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.