National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS01531 
 Genotype y1 sc v1; P{TRiP}attP40 
 Reference Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG5363 
 Symbol Cdk1 
 Full Name Cyclin-dependent kinase 1 
 Synonym CDC2, Cdc2, CDK1, Cdk-1, DmCdc2, CDCDm, 5363, Dmcdc2, Dm cdc2, l(2)31Eh, Cdk1, cdc2Dm, CG5363, Dcdc2, group 4, CDK1/CDC2, cdk1, DmCdk1, cdc2, cdc, dCdk1 
 FBgn FBgn0004106 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 1 out of 1 
 Transcripts
CG5363-RA 
 Accession NM_057449
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP40 
 Hairpin ID
SH01180.N 
 21bp_seq_sense_
ATCGATGGACCTCAAGAAATA 
 21bp_seq_antisense
TATTTCTTGAGGTCCATCGAT 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.