National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS01371 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Katsukawa M, Ohsawa S, Zhang L, Yan Y, Igaki T.
Serpin Facilitates Tumor-Suppressive Cell Competition by Blocking Toll-Mediated Yki Activation in Drosophila.
Curr Biol (2018) 28(11) 1756-1767.e6 [ PubMed ID = 29804808 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG18525 
 Symbol Spn88Ea 
 Full Name Serpin 88Ea 
 Synonym spn5, Spn5, sp5, Sp5, Spn88Ea, CG18525 
 FBgn FBgn0028984 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG18525-RB, CG18525-RA 
 Accession NM_176501NM_080215
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH02065.N 
 21bp_seq_sense_
CAGTCAGTTCAAGACGGAGAA 
 21bp_seq_antisense
TTCTCCGTCTTGAACTGACTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.