National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS00917 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Liaw GJ, Chiang CS.
Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase.
Sci Rep (2019) 9(1) 1885 [ PubMed ID = 30760733 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG8280 
 Symbol Ef1alpha48D 
 Full Name Elongation factor 1alpha48D 
 Synonym EF-1alpha, l(2)1275, EF-1a, F1, EF-1, EF-1alphaF[[1]], EF1alpha48D, clone 1.17, chr2R:7410009..7410129, EF1alpha, EF-1[a], chr2R:7409490..7409690, EF1-alpha, ef-1alpha, Ef1, Ef1alpha48E, EF-1alpha F1, Efalpha48D, Ef1alpha48D, CG8280, Dm0084, 1275, EF-1alphaF, Ef1a10, Ef1alpha1, EF1alpha 48D, DmEF1, F1 EF-1alpha, l(2)01275, anon-EST:Liang-2.46, EF11_DROME, l(2)k07303, EF-1alphaF1, clone 2.46, eEF1alpha, EF, anon-EST:Liang-1.17, Ef1a48D 
 FBgn FBgn0000556 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 4 out of 4 
 Transcripts
CG8280-RC, CG8280-RE, CG8280-RD, CG8280-RA 
 Accession NM_165850NM_058027
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH00342.N 
 21bp_seq_sense_
TCGACGGATACGAATGCTAAA 
 21bp_seq_antisense
TTTAGCATTCGTATCCGTCGA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.