National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 29 April to 13 May, deadline 16 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS00777 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Kosakamoto H, Miura M, Obata F.<br> Epidermal tyrosine catabolism is crucial for metabolic homeostasis and survival against high-protein diets in Drosophila.<br> Development (2024) 151(1) [ PubMed ID = 38165175 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG5680 
 Symbol bsk 
 Full Name basket 
 Synonym CG5680, Bsk, BSK, DJNK/bsk, SAPKa, Jnk, JNK, D-JNK, DBSK/JNK, D-junk, DJNK, pJNK, dJNK, jnk, JNK/SAPK, Junk 
 FBgn FBgn0000229 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, not all isoform(s) 
 Gene target  Transcripts targeted 1 out of 3 
 Transcripts
CG5680-RB 
 Accession NM_164900
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH00845.N 
 21bp_seq_sense_
CCGCAGATAGTTGATTCTTAA 
 21bp_seq_antisense
TTAAGAATCAACTATCTGCGG 
Pathways (updated: 2024/04/26)
 KEGG Pathway dme04013 : MAPK signaling pathway - fly
dme04068 : FoxO signaling pathway
dme04137 : Mitophagy - animal
dme04140 : Autophagy - animal
dme04141 : Protein processing in endoplasmic reticulum
dme04214 : Apoptosis - fly
dme04215 : Apoptosis - multiple species
dme04310 : Wnt signaling pathway
dme04391 : Hippo signaling pathway - fly
dme04624 : Toll and Imd signaling pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.