National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS00540 
 Genotype y1 sc v1; P{TRiP}attP2/TM3,Sb 
 Reference Liaw GJ, Chiang CS.<br> Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase.<br> Sci Rep (2019) 9(1) 1885 [ PubMed ID = 30760733 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014, FB2014_04, released July 21st, 2014 
 CG No. CG1244, CG42245 
 Symbol MEP-1, CG42245 
 Full Name  
 Synonym MEP-1, CG1244, MEP1, dMEP-1, Q0E8J0_DROME, anon-WO0118547.584, clone 1.37, anon-EST:Liang-1.37,  
 FBgn FBgn0035357, FBgn0250911 
 Gene Loc. 3L, 3L 
 Gene Target Summary Target multipul gene 
 Gene target  Transcripts targeted -  
 Transcripts
CG1244-RG, CG1244-RE, CG1244-RF, CG1244-RD, CG1244-RB, CG1244-RA, CG1244-RC, CG42245-RA 
 Accession NM_001144403NM_167961NM_167962NM_167960NM_167958NM_139476NM_167959NM_001144404
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH00673.N 
 21bp_seq_sense_
TCCGACGATGCTGTTCTGATA 
 21bp_seq_antisense
TATCAGAACAGCATCGTCGGA 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.