National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No HMS00398 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Akagawa H, Hara Y, Togane Y, Iwabuchi K, Hiraoka T, Tsujimura H.
The role of the effector caspases drICE and dcp-1 for cell death and corpse clearance in the developing optic lobe in Drosophila.
Dev. Biol. (2015) 404(2) 61-75 [ PubMed ID = 26022392 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG7788 
 Symbol Ice 
 Full Name Ice 
 Synonym DRICE, Drice, ice, DrIce, crice, ICE, drICE, Drive, drice, caspase 3, drIce, CG7788, DrICE 
 FBgn FBgn0019972 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 1 out of 1 
 Transcripts
CG7788-RA 
 Accession NM_079827
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location attP2 
 Hairpin ID
SH00390.N 
 21bp_seq_sense_
TCGACTAAAGTAATTAGTTAA 
 21bp_seq_antisense
TTAACTAATTACTTTAGTCGA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.