National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Stock Detail
 TRiP No HMJ23183 
 Genotype y1 v1; P{TRiP}attP40/CyO 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG1667 
 Symbol CG1667 
 Full Name  
 Synonym  
 FBgn FBgn0033453 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG1667-RC, CG1667-RB 
 Accession
Vector Information
 Vector VALIUM20 
 RNAi expressed soma, germline 
 Hairpin Location
 Hairpin ID
 21bp_seq_sense_
CTGGCAGATGCAGGAACTAAA 
 21bp_seq_antisense
TTTAGTTCCTGCATCTGCCAG 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.