National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 29 April to 13 May, deadline 16 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00174 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Li Y, Sun X, Gao D, Ding Y, Liu J, Chen J, Luo J, Zhang J, Liu Q, Zhou Z.<br> Dual functions of Rack1 in regulating Hedgehog pathway.<br> Cell Death Differ (2020) 27(11) 3082-3096 [ PubMed ID = 32467643 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG1954 
 Symbol Pkc98E 
 Full Name Protein C kinase 98E 
 Synonym PKC 98F, PKC, PKC d98F, Pkc3, Nc98F, PKC98E, dPKC98F, PKC-98F, PK-C, nPKC, Dpkc3, CG1954, 98F, PKCdelta 
 FBgn FBgn0003093 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 4 out of 4 
 Transcripts
CG1954-RD, CG1954-RC, CG1954-RB, CG1954-RA 
 Accession NM_001170296NM_079821
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01423.N2 
 21bp_seq_sense_
CACGTTAGTTGTACATAAGAA 
 21bp_seq_antisense
TTCTTATGTACAACTAACGTG 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.