National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00066 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG43143 
 Symbol CG43143 
 Full Name  
 Synonym NUAK, CG11871, CG11872, CG11870, Omphk1, EMK/KIAA0537 
 FBgn FBgn0262617 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 9 out of 9 
 Transcripts
CG43143-RI, CG43143-RH, CG43143-RG, CG43143-RF, CG43143-RE, CG43143-RB, CG43143-RC, CG43143-RA, CG43143-RD 
 Accession NM_001275529NM_001275528NM_001260091NM_001260090NM_141736NM_169337NM_206470NM_141734NM_206469
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01438.N2 
 21bp_seq_sense_
TAGCTCGTTTGTGATCAGCAA 
 21bp_seq_antisense
TTGCTGATCACAAACGAGCTA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.