National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail
 TRiP No GL00058 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG4201 
 Symbol ird5 
 Full Name immune response deficient 5 
 Synonym Lak, CG4201, ird5/DmIkk[beta], ird, dmIKKbeta, dIKK, IKKbeta, IK, Ird5, dIKK-beta, dLak, Ird-5, LRK, IRD-5, ird-5, IKKB, Dmikkbeta, DIK, IKKb, IRD5, Dmikkb, IKK, dIKKbeta, IKK-beta, anon-89Bd, DmIKK, DmIKKb, ikk, DmIKKBeta, Ikkbeta, DmIkkbeta, DmIKKbeta, Ikkb, DLAK, Ik 
 FBgn FBgn0024222 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 1 out of 1 
 Transcripts
CG4201-RB 
 Accession NM_080012
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01400.N2 
 21bp_seq_sense_
AAGAAAGAGTGTGACTACAAA 
 21bp_seq_antisense
TTTGTAGTCACACTCTTTCTT 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.