National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00057 
 Genotype y1 sc v1; P{TRiP}attP2/TM3,Sb 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG9748 
 Symbol bel 
 Full Name belle 
 Synonym belle, cg9748, ms(3)Pneo85A, BEL, DmRH6, l(3)L4740, CG9748, ms(3)neo30, l(3)85Ac, anon-85Ab, Bel, cap, L3, l(3)L3, l(3)S047110, l(3)S097074 
 FBgn FBgn0263231 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG9748-RB, CG9748-RA 
 Accession NM_001275450NM_080522
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01269.N2 
 21bp_seq_sense_
ATGAGTAATGCTATTAACCAA 
 21bp_seq_antisense
TTGGTTAATAGCATTACTCAT 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.