National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00056 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG4170 
 Symbol vig 
 Full Name vasa intronic gene 
 Synonym CG4170, VIG, BG:DS00929.13, Vig, EP(2)0812 
 FBgn FBgn0024183 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 4 out of 4 
 Transcripts
CG4170-RB, CG4170-RA, CG4170-RC, CG4170-RD 
 Accession NM_165100NM_078848NM_165101NM_165102
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01267.N2 
 21bp_seq_sense_
TACGTATATCACAGACAACAA 
 21bp_seq_antisense
TTGTTGTCTGTGATATACGTA 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.