National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00054 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG13190 
 Symbol cuff 
 Full Name cutoff 
 Synonym CG13190 
 FBgn FBgn0260932 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target 1   Transcripts targeted 1 out of 1 
 Transcripts 
CG13190-RA 
 Accession NM_136865
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID 
SH01261.N2 
 21bp_seq_sense_ 
CCGGATGATGCTGGACGATCA 
 21bp_seq_antisense 
TGATCGTCCAGCATCATCCGG 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
 Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.