National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00052 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG18492 
 Symbol Tak1 
 Full Name TGF-beta activated kinase 1 
 Synonym tak1, dTak, D10, CG18492, DTak, dTAK1, TAK-1, CG1388, TAK1, dtak1, tak, DmTak1, TAK, Tak 1, dTAK, dTAK-1, dTak1, D-tak, Tak, DTak1, D-TAK, DTAK1 
 FBgn FBgn0026323 
 Gene Loc.
 Gene Target Summary Target 1 gene, not all isoform(s) 
 Gene target  Transcripts targeted 1 out of 2 
 Transcripts
CG18492-RA 
 Accession NM_079356
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01253.N2 
 21bp_seq_sense_
ATCGATGACGGTCTTGTTAAA 
 21bp_seq_antisense
TTTAACAAGACCGTCATCGAT 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.