National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00047 
 Genotype y1 sc v1; P{TRiP}attP2/TM3,Sb 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG10967 
 Symbol Atg1 
 Full Name Autophagy-specific gene 1 
 Synonym dATG1, DmATG1, Unc-51, dAtg1, unc51, CG10967, l(3)00305, Unc51, anon-WO0118547.287, UNC 51-like, DK-4, atg1, unc-51, ATG1, ULK1 
 FBgn FBgn0260945 
 Gene Loc. 3L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG10967-RB, CG10967-RA 
 Accession NM_001169962NM_140344
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01244.N2 
 21bp_seq_sense_
ACCGATGAGAATGCTTAGTTA 
 21bp_seq_antisense
TAACTAAGCATTCTCATCGGT 
Pathways (updated: 2024/04/26)
 KEGG Pathway dme04136 : Autophagy - other
dme04140 : Autophagy - animal
dme04150 : mTOR signaling pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.