National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Temporarily suspending orders:

For system maintenance, the order acceptance will be suspended from 9:00 17th March 2019 to 20:00.

We apologize for the inconvenience.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00039 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG4488 
 Symbol Wee1 
 Full Name Wee1 ortholog (S. pombe) 
 Synonym Wee1, wee, Wee 1, Wee, Dwee, WEE1, wee1, Dwee1, CG4488, dWee1, dwee1 
 FBgn FBgn0011737 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG4488-RB, CG4488-RA 
 Accession NM_001273238NM_057687
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01236.N2 
 21bp_seq_sense_
CAGCAGCTGGACAGTAAGATA 
 21bp_seq_antisense
TATCTTACTGTCCAGCTGCTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.