National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00026 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Dorogova NV, Khruscheva AS, Galimova IA, Oshchepkov DY, Maslov DE, Shvedkina ED, Akhmetova KA, Fedorova SA.<br> Migration of primordial germline cells is negatively regulated by surrounding somatic cells during early embryogenesis in Drosophila melanogaster.<br> Vavilovskii Zhurnal Genet Selektsii (2020) 24(5) 525-532 [ PubMed ID = 33659837 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG10033 
 Symbol for 
 Full Name foraging 
 Synonym dg2, Pkg24A, anon-WO0140519.260, For, Pkg2, BcDNA:GM08338, DG2, l(2)06860, anon-WO02059370.47, Dg2, FOR/PKG, 142251_at, PKG, CG10033 
 FBgn FBgn0000721 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 9 out of 9 
 Transcripts
CG10033-RK, CG10033-RA, CG10033-RI, CG10033-RG, CG10033-RD, CG10033-RH, CG10033-RJ, CG10033-RC, CG10033-RE 
 Accession NM_001169387NM_058139NM_205904NM_205907NM_134319NM_205906NM_001014464NM_058141NM_058142
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01194.N2 
 21bp_seq_sense_
TTCCTAGACGATGCTCTCTAA 
 21bp_seq_antisense
TTAGAGAGCATCGTCTAGGAA 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.