National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00021 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG2028 
 Symbol CkIalpha 
 Full Name Casein kinase Ialpha 
 Synonym ck1a, CK I, PKA-C, CKI, CG2028, anon-WO03040301.93, CkIa, anon-WO03040301.95, CK1, CK1alpha, CKIalpha, CK1a, CkIalpha, l(1)G0492, ck1alpha, CKI alpha, dmckI, dmCK1, CKIa, CkI alpha 
 FBgn FBgn0015024 
 Gene Loc.
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 6 out of 6 
 Transcripts
CG2028-RG, CG2028-RF, CG2028-RD, CG2028-RE, CG2028-RA, CG2028-RB 
 Accession NM_001169266NM_167331NM_078585
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01172.N2 
 21bp_seq_sense_
ACCGAAATTATTGCAAATCAA 
 21bp_seq_antisense
TTGATTTGCAATAATTTCGGT 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.