National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00020 
 Genotype y1 sc v1; P{TRiP}attP2/TM3,Sb 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG10895 
 Symbol lok 
 Full Name loki 
 Synonym 38B.4, CHK-2, 10895, chk2, DmChk2, loki, Dmchk2, Dmnk, CG10895, Dmnk-S, CHK2, chk2/lok, Chk2, mnk, DmCHk2, Dmnk-L, chk, MNK, Dmnk/DChk2, LOKI/CHK2 
 FBgn FBgn0019686 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 4 out of 4 
 Transcripts
CG10895-RD, CG10895-RC, CG10895-RB, CG10895-RA 
 Accession NM_001259171NM_165318NM_057870NM_057871
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01168.N2 
 21bp_seq_sense_
CAGGATGCGAATCCTAAAGAA 
 21bp_seq_antisense
TTCTTTAGGATTCGCATCCTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.