National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00019 
 Genotype y1 sc v1; P{TRiP}attP2/TM3,Sb 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG9374 
 Symbol lkb1 
 Full Name lkb1 
 Synonym LKB1, STK11, DmLKB1, PAR-4, Lkb1, par-4, dlkb1, anon-EST:Posey135, dLKB1, CG9374, PAR4, LKB1/PEUTZ JEGHERS KINASE 
 FBgn FBgn0038167 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 9 out of 9 
 Transcripts
CG9374-RJ, CG9374-RD, CG9374-RC, CG9374-RB, CG9374-RA, CG9374-RI, CG9374-RH, CG9374-RF, CG9374-RE 
 Accession NM_001170135NM_169543NM_169542NM_142045NM_169541NM_169547NM_169546NM_169545NM_169544
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01158.N2 
 21bp_seq_sense_
CACGGTTACTTCAAACAGCTA 
 21bp_seq_antisense
TAGCTGTTTGAAGTAACCGTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.