National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00017 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG1828 
 Symbol dre4 
 Full Name dre4 
 Synonym dspt16, DRE4/dSPT16, CG1828, spt16, Spt16, dSPT16, SPT16, dSpt16, l(3)dre4, l(3)62Bg 
 FBgn FBgn0002183 
 Gene Loc. 3L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG1828-RA, CG1828-RB 
 Accession NM_057262NM_167922
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01360.N2 
 21bp_seq_sense_
CAAGGTGGACATCTTGTACAA 
 21bp_seq_antisense
TTGTACAAGATGTCCACCTTG 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.