National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00015 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG14217 
 Symbol Tao 
 Full Name Tao 
 Synonym dTao-1, AAF48973, tao, tao1, tao-1, CG14217, TAO1, Tao-1, MARKK 
 FBgn FBgn0031030 
 Gene Loc.
 Gene Target Summary Target 1 gene, not all isoform(s) 
 Gene target  Transcripts targeted 7 out of 9 
 Transcripts
CG14217-RI, CG14217-RG, CG14217-RF, CG14217-RA, CG14217-RB, CG14217-RD, CG14217-RE 
 Accession NM_001272779NM_001201744NM_001201743NM_134475NM_167667NM_167665NM_167666
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01171.N2 
 21bp_seq_sense_
CACGAGAAGCATACTAAAGAA 
 21bp_seq_antisense
TTCTTTAGTATGCTTCTCGTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.