National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00008 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG10295 
 Symbol Pak 
 Full Name PAK-kinase 
 Synonym Dpak, dpak, p65[PAK], PaK, Pak1, DPak, Dpak1, dPak, D-Pak, DmPAK1, PAK1, pak, PAK2, pak1, DPak1, dPAK, dpak1, DPAK, dPAK1, PAK, CG10295 
 FBgn FBgn0014001 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 9 out of 9 
 Transcripts
CG10295-RJ, CG10295-RI, CG10295-RH, CG10295-RG, CG10295-RF, CG10295-RE, CG10295-RB, CG10295-RA, CG10295-RC 
 Accession NM_001275384NM_001275383NM_001275382NM_001144541NM_001275381NM_001275380NM_079942NM_169136NM_169137
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01221.N2 
 21bp_seq_sense_
CACGACGACGCTGGACAAGAA 
 21bp_seq_antisense
TTCTTGTCCAGCGTCGTCGTG 
Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.