National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00003 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG17520 
 Symbol CkIIalpha 
 Full Name casein kinase IIalpha 
 Synonym CKII-alpha, ck2alpha, Ck2alpha, CKIIa, CK2-alpha, CK2, CK-II, CKII alpha, CJIIalpha, Tik, CKII, CK-2, CK2a, CkIIalpha, CG17520, Cask-II-a, CkII, CK2alpha, anon-WO02059370.53, 0958/08, CKIIalfa, DmCK2alpha, l(3)S095808, CK II, alphaCK2, dCKII alpha, ckIIalpha, CK2 alpha, CK-II alpha, CKIIalpha, dCKII, DmCKIIalpha, dCK2alpha 
 FBgn FBgn0264492 
 Gene Loc. 3L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 7 out of 7 
 Transcripts
CG17520-RA, CG17520-RC, CG17520-RB, CG17520-RD, CG17520-RE, CG17520-RG, CG17520-RF 
 Accession NM_168985NM_168986NM_080179NM_001043159
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01174.N2 
 21bp_seq_sense_
TCGCGTGTACACAGATGTCAA 
 21bp_seq_antisense
TTGACATCTGTGTACACGCGA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.