National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00002 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG8553 
 Symbol SelD 
 Full Name Selenide%2Cwater dikinase 
 Synonym anon-WO0172774.146, anon-WO0172774.145, Dm SelD, ptuf1, 142926_at, CG8553, selD/sps1, selD, l(2)k12303, Dm-SelD, l(2)SH1599, dsps1, ptuf, SeS, SPS1, ptf1, l(2)SH2 1599, dSPS1 
 FBgn FBgn0261270 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 2 out of 2 
 Transcripts
CG8553-RA, CG8553-RB 
 Accession NM_166045NM_166046
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01164.N2 
 21bp_seq_sense_
TTGGACGTCTCTACTGCAATA 
 21bp_seq_antisense
TATTGCAGTAGAGACGTCCAA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.